deliberate 有意的，深思熟虑的discuss，intentional

---

title: deliberate
date: 2018-11-09 09:06:46
NO_sents: 602
NO_references: 196

---

deliberate
deliberated
deliberately
deliberates
deliberating
deliberation
deliberations
deliberative
deliberatively

• The deliberate objective was to release both pines and oaks to promote a mixed pine-hardwood regeneration cohort (photo by Richard Straight). (Kabrick et al., 2007)
• This was a deliberate choice of example, as it gives an excuse to talk about some optional arguments, including different translation tables (Genetic Codes). (Chapman et al., 2000)
• This is deliberate, partly for backwards compatibility reasons, but it also makes sense if you have a FASTA file like this: >Yersinia pestis biovar Microtus str. 91001 plasmid pPCP1 TGTAACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAATCTGCTCTCC ... (Chapman et al., 2000)
• In some cases this is deliberate (e.g. lower case for poor quality regions), but usually it is not important. (Chapman et al., 2000)
• This was a deliberate design choice by Illumina, meaning applications expecting the old fasta-solexa style files will probably be OK using the newer fastq-illumina files (on good data). (Chapman et al., 2000)
• However, the assessment of kino induced in a controlled manner across genotypes through deliberate injury of the cambium [12] may have been more likely to reveal significant genetic differences. (Hamilton et al., 2007)
• People often make deliberate errors when entering personal data into databases. (Witten et al., 2016)
• We emphasized in Chapter 2, Input: concepts, instances, attributes, the necessity of getting to know your data: understanding the meaning of all the different attributes, the conventions used in coding them, the significance of missing values and duplicate data, measurement noise, typographical errors, and the presence of systematic errors--even deliberate ones. (Witten et al., 2016)
• This deliberate policy of reducing the harvest from natural stands while at the same time investing in the development of a viable plantation program has lead to the preservation of large areas of natural Araucaria forests in Queensland. (Dieters, Nikles, Keys, 2007)
• Using deliberate inbreeding to purge recessive alleles to alleviate the long-term inbreeding issue (Wu et al 2004a). (Wu et al., 2007)
• For these reasons, deliberate inbreeding and genetic infusion of radiata pine breeding populations should be critical components of breeding strategy. (Wu et al., 2007)