Introduction
What is Bowtie 2?
Bowtie 2 is an ultrafast and memory-efficient tool for aligning sequencing
reads to long reference sequences. It is particularly good at aligning reads of
about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian)
genomes. Bowtie 2 indexes the genome with an FM Index (based on the
Burrows-Wheeler Transform or BWT) to keep its memory footprint small: for
the human genome, its memory footprint is typically around 3.2 gigabytes of RAM.
Bowtie 2 supports gapped, local, and paired-end alignment modes. Multiple
processors can be used simultaneously to achieve greater alignment speed.
Bowtie 2 outputs alignments in SAM format, enabling interoperation with a
large number of other tools (e.g. SAMtools, GATK) that use SAM. Bowtie 2 is
distributed under the GPLv3 license, and it runs on the command line under
Windows, Mac OS X and Linux.
Bowtie 2 is often the first step in pipelines for comparative genomics,
including for variation calling, ChIP-seq, RNA-seq, BS-seq. Bowtie 2 and
Bowtie (also called "Bowtie 1" here) are also tightly integrated into some
tools, including TopHat: a fast splice junction mapper for RNA-seq reads,
Cufflinks: a tool for transcriptome assembly and isoform quantitiation from
RNA-seq reads, Crossbow: a cloud-enabled software tool for analyzing
reseuqncing data, and Myrna: a cloud-enabled software tool for aligning
RNA-seq reads and measuring differential gene expression.
If you use Bowtie 2 for your published research, please cite the Bowtie
paper. Thank you!
How is Bowtie 2 different from Bowtie 1?
Bowtie 1 was released in 2009 and was geared toward aligning the relatively
short sequencing reads (up to 25-50 nucleotides) prevalent at the time. Since
then, technology has improved both sequencing throughput (more nucleotides
produced per sequencer per day) and read length (more nucleotides per read).
The chief differences between Bowtie 1 and Bowtie 2 are:
For reads longer than about 50 bp Bowtie 2 is generally faster, more
sensitive, and uses less memory than Bowtie 1. For relatively short reads (e.g.
less than 50 bp) Bowtie 1 is sometimes faster and/or more sensitive.Bowtie 2 supports gapped alignment with affine gap penalties. Number of gaps
and gap lengths are not restricted, except by way of the configurable scoring
scheme. Bowtie 1 finds just ungapped alignments.Bowtie 2 supports local alignment, which doesn't require reads to align
end-to-end. Local alignments might be "trimmed" ("soft clipped") at one or both
extremes in a way that optimizes alignment score. Bowtie 2 also supports
end-to-end alignment which, like Bowtie 1, requires that the read align
entirely.There is no upper limit on read length in Bowtie 2. Bowtie 1 had an upper
limit of around 1000 bp.Bowtie 2 allows alignments to overlap ambiguous characters (e.g.
Ns) in
the reference. Bowtie 1 does not.Bowtie 2 does away with Bowtie 1's notion of alignment "stratum", and its
distinction between "Maq-like" and "end-to-end" modes. In Bowtie 2 all
alignments lie along a continuous spectrum of alignment scores where the
scoring scheme, similar to Needleman-Wunsch and Smith-Waterman.Bowtie 2's paired-end alignment is more flexible. E.g. for pairs that do
not align in a paired fashion, Bowtie 2 attempts to find unpaired alignments for
each mate.Bowtie 2 reports a spectrum of mapping qualities, in contrast fo Bowtie 1
which reports either 0 or high.Bowtie 2 does not align colorspace reads.
Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's command-line
arguments and genome index format are both different from Bowtie 1's.
What isn't Bowtie 2?
Bowtie 1 and Bowtie 2 are not general-purpose alignment tools like MUMmer,
BLAST or Vmatch. Bowtie 2 works best when aligning to large genomes, though
it supports arbitrarily small reference sequences (e.g. amplicons). It handles
very long reads (i.e. upwards of 10s or 100s of kilobases), but it is optimized
for the read lengths and error modes yielded by recent sequencers, such as the
Illumina HiSeq 2000, Roche 454, and Ion Torrent instruments.
If your goal is to align two very large sequences (e.g. two genomes), consider
using MUMmer. If your goal is very sensitive alignment to a relatively short
reference sequence (e.g. a bacterial genome), this can be done with Bowtie 2 but
you may want to consider using tools like NUCmer, BLAT, or BLAST. These
tools can be extremely slow when the reference genome is long, but are often
adequate when the reference is short.
Bowtie 2 does not support alignment of colorspace reads. This might be
supported in future versions.
What does it mean that some older Bowtie 2 versions are "beta"?
We said those Bowtie 2 versions were in "beta" to convey that it was not as
polished as a tool that had been around for a while, and was still in flux.
Since version 2.0.1, we declared Bowtie 2 was no longer "beta".
Obtaining Bowtie 2
Download Bowtie 2 sources and binaries from the Download section of the
Sourceforge site. Binaries are available for the Intel x86_64 architecture
running Linux, Mac OS X, and Windows. If you plan to compile Bowtie 2 yourself,
make sure to get the source package, i.e., the filename that ends in
"-source.zip".
Building from source
Building Bowtie 2 from source requires a GNU-like environment with GCC, GNU Make
and other basics. It should be possible to build Bowtie 2 on most vanilla Linux
installations or on a Mac installation with Xcode installed. Bowtie 2 can
also be built on Windows using a 64-bit MinGW distribution and MSYS. In order
to simplify the MinGW setup it might be worth investigating popular MinGW personal
builds since these are coming already prepared with most of the toolchains needed.
First, download the source package from the sourceforge site. Make sure
you're getting the source package; the file downloaded should end in
-source.zip. Unzip the file, change to the unzipped directory, and build the
Bowtie 2 tools by running GNU make (usually with the command make, but
sometimes with gmake) with no arguments. If building with MinGW, run make
from the MSYS environment.
Bowtie 2 is using the multithreading software model in order to speed up
execution times on SMP architectures where this is possible. On POSIX
platforms (like linux, Mac OS, etc) it needs the pthread library. Although
it is possible to use pthread library on non-POSIX platform like Windows, due
to performance reasons bowtie 2 will try to use Windows native multithreading
if possible.
Adding to PATH
By adding your new Bowtie 2 directory to your PATH environment variable, you
ensure that whenever you run bowtie2, bowtie2-build or bowtie2-inspect
from the command line, you will get the version you just installed without
having to specify the entire path. This is recommended for most users. To do
this, follow your operating system's instructions for adding the directory to
your PATH.
If you would like to install Bowtie 2 by copying the Bowtie 2 executable files
to an existing directory in your PATH, make sure that you copy all the
executables, including bowtie2, bowtie2-align-s, bowtie2-align-l,
bowtie2-build, bowtie2-build-s, bowtie2-build-l, bowtie2-inspect,
bowtie2-inspect-s and bowtie2-inspect-l.
The bowtie2 aligner
bowtie2 takes a Bowtie 2 index and a set of sequencing read files and outputs
a set of alignments in SAM format.
"Alignment" is the process by which we discover how and where the read sequences
are similar to the reference sequence. An "alignment" is a result from this
process, specifically: an alignment is a way of "lining up" some or all of the
characters in the read with some characters from the reference in a way that
reveals how they're similar. For example:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
Where dash symbols represent gaps and vertical bars show where aligned
characters match.
We use alignment to make an educated guess as to where a read originated with
respect to the reference genome. It's not always possible to determine this
with certainty. For instance, if the reference genome contains several long
stretches of As (AAAAAAAAA etc) and the read sequence is a short stretch of As
(AAAAAAA), we cannot know for certain exactly where in the sea of As the
read originated.
End-to-end alignment versus local alignment
By default, Bowtie 2 performs end-to-end read alignment. That is, it searches
for alignments involving all of the read characters. This is also called an
"untrimmed" or "unclipped" alignment.
When the --local option is specified, Bowtie 2 performs local read alignment. In
this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both
ends of the alignment if doing so maximizes the alignment score.
End-to-end alignment example
The following is an "end-to-end" alignment because it involves all the
characters in the read. Such an alignment can be produced by Bowtie 2 in either
end-to-end mode or in local mode.
Read: GACTGGGCGATCTCGACTTCG
Reference: GACTGCGATCTCGACATCG
Alignment:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
Local alignment example
The following is a "local" alignment because some of the characters at the ends
of the read do not participate. In this case, 4 characters are omitted (or
"soft trimmed" or "soft clipped") from the beginning and 3 characters are
omitted from the end. This sort of alignment can be produced by Bowtie 2 only
in local mode.
Read: ACGGTTGCGTTAATCCGCCACG
Reference: TAACTTGCGTTAAATCCGCCTGG
Alignment:
Read: ACGGTTGCGTTAA-TCCGCCACG
||||||||| ||||||
Reference: TAACTTGCGTTAAATCCGCCTGG
Scores: higher = more similar
An alignment score quantifies how similar the read sequence is to the reference
sequence aligned to. The higher the score, the more similar they are. A score
is calculated by subtracting penalties for each difference (mismatch, gap, etc)
and, in local alignment mode, adding bonuses for each match.
The scores can be configured with the --ma (match bonus), --mp (mismatch
penalty), --np (penalty for having an N in either the read or the
reference), --rdg (affine read gap penalty) and --rfg (affine reference
gap penalty) options.
End-to-end alignment score example
A mismatched base at a high-quality position in the read receives a penalty of
-6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for
the gap open, -3 for the first extension, -3 for the second extension). Thus,
in end-to-end alignment mode, if the read is 50 bp long and it matches the
reference exactly except for one mismatch at a high-quality position and one
length-2 read gap, then the overall score is -(6 + 11) = -17.
The best possible alignment score in end-to-end mode is 0, which happens when
there are no differences between the read and the reference.
Local alignment score example
A mismatched base at a high-quality position in the read receives a penalty of
-6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for
the gap open, -3 for the first extension, -3 for the second extension). A base
that matches receives a bonus of +2 be default. Thus, in local alignment mode,
if the read is 50 bp long and it matches the reference exactly except for one
mismatch at a high-quality position and one length-2 read gap, then the overall
score equals the total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.
The best possible score in local mode equals the match bonus times the length of
the read. This happens when there are no differences between the read and the
reference.
Valid alignments meet or exceed the minimum score threshold
For an alignment to be considered "valid" (i.e. "good enough") by Bowtie 2, it
must have an alignment score no less than the minimum score threshold. The
threshold is configurable and is expressed as a function of the read length. In
end-to-end alignment mode, the default minimum score threhsold is -0.6 + -0.6 * L, where L is the read length. In local alignment mdoe, the default minimum
score threshold is 20 + 8.0 * ln(L), where L is the read length. This can be
configured with the --score-min option. For details on how to set options
like --score-min that correpond to functions, see the section on setting
function options.
Mapping quality: higher = more unique
The aligner cannot always assign a read to its point of origin with high
confidence. For instance, a read that originated inside a repeat element might
align equally well to many occurrences of the element throughout the genome,
leaving the aligner with no basis for preferring one over the others.
Aligners characterize their degree of confidence in the point of origin by
reporting a mapping quality: a non-negative integer Q = -10 log10 p, where p is
an estimate of the probability that the alignment does not correspond to the
read's true point of origin. Mapping quality is sometimes abbreviated MAPQ, and
is recorded in the SAM MAPQ field.
Mapping quality is related to "uniqueness." We say an alignment is unique if it
has a much higher alignment score than all the other possible alignments. The
bigger the gap between the best alignment's score and the second-best
alignment's score, the more unique the best alignment, and the higher its mapping
quality should be.
Accurate mapping qualities are useful for downstream tools like variant callers.
For instance, a variant caller might choose to ignore evidence from alignments
with mapping quality less than, say, 10. A mapping quality of 10 or less
indicates that there is at least a 1 in 10 chance that the read truly originated
elsewhere.
Aligning pairs
A "paired-end" or "mate-pair" read consists of pair of mates, called mate 1 and
mate 2. Pairs come with a prior expectation about (a) the relative orientation
of the mates, and (b) the distance separating them on the original DNA molecule.
Exactly what expectations hold for a given dataset depends on the lab procedures
used to generate the data. For example, a common lab procedure for producing
pairs is Illumina's Paired-end Sequencing Assay, which yields pairs with a
relative orientation of FR ("forward, reverse") meaning that if mate 1 came from
the Watson strand, mate 2 very likely came from the Crick strand and vice versa.
Also, this protocol yields pairs where the expected genomic distance from end
to end is about 200-500 base pairs.
For simplicity, this manual uses the term "paired-end" to refer to any pair of
reads with some expected relative orientation and distance. Depending on the
protocol, these might actually be referred to as "paired-end" or "mate-paired."
Also, we always refer to the individual sequences making up the pair as "mates."
Paired inputs
Pairs are often stored in a pair of files, one file containing the mate 1s and
the other containing the mates 2s. The first mate in the file for mate 1 forms
a pair with the first mate in the file for mate 2, the second with the second,
and so on. When aligning pairs with Bowtie 2, specify the file with the mate 1s
mates using the -1 argument and the file with the mate 2s using the -2
argument. This causes Bowtie 2 to take the paired nature of the reads into
account when aligning them.
Paired SAM output
When Bowtie 2 prints a SAM alignment for a pair, it prints two records (i.e. two
lines of output), one for each mate. The first record describes the alignment
for mate 1 and the second record describes the alignment for mate 2. In both
records, some of the fields of the SAM record describe various properties of the
alignment; for instance, the 7th and 8th fields (RNEXT and PNEXT
respectively) indicate the reference name and position where the other mate
aligned, and the 9th field indicates the inferred length of the DNA fragment
from which the two mates were sequenced. See the SAM specification for more
details regarding these fields.
Concordant pairs match pair expectations, discordant pairs don't
A pair that aligns with the expected relative mate orientation and with the
expected range of distances between mates is said to align "concordantly". If
both mates have unique alignments, but the alignments do not match paired-end
expectations (i.e. the mates aren't in the expcted relative orientation, or
aren't within the expected disatance range, or both), the pair is said to align
"discordantly". Discordant alignments may be of particular interest, for
instance, when seeking structural variants.
The expected relative orientation of the mates is set using the --ff,
--fr, or --rf options. The expected range of inter-mates distances (as
measured from the furthest extremes of the mates; also called "outer distance")
is set with the -I and -X options. Note that setting -I and -X
far apart makes Bowtie 2 slower. See documentation for -I and -X.
To declare that a pair aligns discordantly, Bowtie 2 requires that both mates
align uniquely. This is a conservative threshold, but this is often desirable
when seeking structural variants.
By default, Bowtie 2 searches for both concordant and discordant alignments,
though searching for discordant alignments can be disabled with the
--no-discordant option.
Mixed mode: paired where possible, unpaired otherwise
If Bowtie 2 cannot find a paired-end alignment for a pair, by default it will go
on to look for unpaired alignments for the constituent mates. This is called
"mixed mode." To disable mixed mode, set the --no-mixed option.
Bowtie 2 runs a little faster in --no-mixed mode, but will only consider
alignment status of pairs per se, not individual mates.
Some SAM FLAGS describe paired-end properties
The SAM FLAGS field, the second field in a SAM record, has multiple bits that
describe the paired-end nature of the read and alignment. The first (least
significant) bit (1 in decimal, 0x1 in hexidecimal) is set if the read is part
of a pair. The second bit (2 in decimal, 0x2 in hexidecimal) is set if the read
is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in
decimal, 0x8 in hexidecimal) is set if the read is part of a pair and the other
mate in the pair had at least one valid alignment. The sixth bit (32 in
decimal, 0x20 in hexidecimal) is set if the read is part of a pair and the other
mate in the pair aligned to the Crick strand (or, equivalently, if the reverse
complement of the other mate aligned to the Watson strand). The seventh bit (64
in decimal, 0x40 in hexidecimal) is set if the read is mate 1 in a pair. The
eighth bit (128 in decimal, 0x80 in hexidecimal) is set if the read is mate 2 in
a pair. See the SAM specification for a more detailed description of the
FLAGS field.
Some SAM optional fields describe more paired-end properties
The last severeal fields of each SAM record usually contain SAM optional fields,
which are simply tab-separated strings conveying additional information about
the reads and alignments. A SAM optional field is formatted like this: "XP:i:1"
where "XP" is the TAG, "i" is the TYPE ("integer" in this case), and "1" is
the VALUE. See the SAM specification for details regarding SAM optional
fields.
Mates can overlap, contain, or dovetail each other
The fragment and read lengths might be such that alignments for the two mates
from a pair overlap each other. Consider this example:
(For these examples, assume we expect mate 1 to align to the left of mate 2.)
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTT
Mate 2: TGTTTGGGGTGACACATTACGCGTCTTTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
It's also possible, though unusual, for one mate alignment to contain the other,
as in these examples:
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TGTTTGGGGTGACACATTACGC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
Mate 1: CAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: CTACGATATTGTTTGGGGTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
And it's also possible, though unusual, for the mates to "dovetail", with the
mates seemingly extending "past" each other as in this example:
Mate 1: GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
In some situations, it's desirable for the aligner to consider all these cases
as "concordant" as long as other paired-end constraints are not violated. Bowtie
2's default behavior is to consider overlapping and containing as being
consistent with concordant alignment. By default, dovetailing is considered
inconsistent with concordant alignment.
These defaults can be overridden. Setting --no-overlap causes Bowtie 2 to
consider overlapping mates as non-concordant. Setting --no-contain causes
Bowtie 2 to consider cases where one mate alignment contains the other as
non-concordant. Setting --dovetail causes Bowtie 2 to consider cases where
the mate alignments dovetail as concordant.
Reporting
The reporting mode governs how many alignments Bowtie 2 looks for, and how to
report them. Bowtie 2 has three distinct reporting modes. The default
reporting mode is similar to the default reporting mode of many other read
alignment tools, including BWA. It is also similar to Bowtie 1's -M
alignment mode.
In general, when we say that a read has an alignment, we mean that it has a
valid alignment. When we say that a read has multiple alignments, we mean
that it has multiple alignments that are valid and distinct from one another.
Distinct alignments map a read to different places
Two alignments for the same individual read are "distinct" if they map the same
read to different places. Specifically, we say that two alignments are distinct
if there are no alignment positions where a particular read offset is aligned
opposite a particular reference offset in both alignments with the same
orientation. E.g. if the first alignment is in the forward orientation and
aligns the read character at read offset 10 to the reference character at
chromosome 3, offset 3,445,245, and the second alignment is also in the forward
orientation and also aligns the read character at read offset 10 to the
reference character at chromosome 3, offset 3,445,245, they are not distinct
alignments.
Two alignments for the same pair are distinct if either the mate 1s in the two
paired-end alignments are distinct or the mate 2s in the two alignments are
distinct or both.
Default mode: search for multiple alignments, report the best one
By default, Bowtie 2 searches for distinct, valid alignments for each read. When
it finds a valid alignment, it generally will continue to look for alignments
that are nearly as good or better. It will eventually stop looking, either
because it exceeded a limit placed on search effort (see -D and -R) or
because it already knows all it needs to know to report an alignment.
Information from the best alignments are used to estimate mapping quality (the
MAPQ SAM field) and to set SAM optional fields, such as AS:i and
XS:i. Bowtie 2 does not gaurantee that the alignment reported is the best
possible in terms of alignment score.
See also: -D, which puts an upper limit on the number of dynamic programming
problems (i.e. seed extensions) that can "fail" in a row before Bowtie 2 stops
searching. Increasing -D makes Bowtie 2 slower, but increases the
likelihood that it will report the correct alignment for a read that aligns many
places.
See also: -R, which sets the maximum number of times Bowtie 2 will "re-seed"
when attempting to align a read with repetitive seeds. Increasing -R makes
Bowtie 2 slower, but increases the likelihood that it will report the correct
alignment for a read that aligns many places.
-k mode: search for one or more alignments, report each
In -k mode, Bowtie 2 searches for up to N distinct, valid alignments for
each read, where N equals the integer specified with the -k parameter. That
is, if -k 2 is specified, Bowtie 2 will search for at most 2 distinct
alignments. It reports all alignments found, in descending order by alignment
score. The alignment score for a paired-end alignment equals the sum of the
alignment scores of the individual mates. Each reported read or pair alignment
beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS
field. See the SAM specification for details.
Bowtie 2 does not "find" alignments in any specific order, so for reads that
have more than N distinct, valid alignments, Bowtie 2 does not gaurantee that
the N alignments reported are the best possible in terms of alignment score.
Still, this mode can be effective and fast in situations where the user cares
more about whether a read aligns (or aligns a certain number of times) than
where exactly it originated.
-a mode: search for and report all alignments
-a mode is similar to -k mode except that there is no upper limit on the
number of alignments Bowtie 2 should report. Alignments are reported in
descending order by alignment score. The alignment score for a paired-end
alignment equals the sum of the alignment scores of the individual mates. Each
reported read or pair alignment beyond the first has the SAM 'secondary' bit
(which equals 256) set in its FLAGS field. See the SAM specification for
details.
Some tools are designed with this reporting mode in mind. Bowtie 2 is not! For
very large genomes, this mode is very slow.
Randomness in Bowtie 2
Bowtie 2's search for alignments for a given read is "randomized." That is,
when Bowtie 2 encouters a set of equally-good choices, it uses a pseudo-random
number to choose. For example, if Bowtie 2 discovers a set of 3 equally-good
alignments and wants to decide which to report, it picks a pseudo-random integer
0, 1 or 2 and reports the corresponding alignment. Abitrary choices can crop up
at various points during alignment.
The pseudo-random number generator is re-initialized for every read, and the
seed used to initialize it is a function of the read name, nucleotide string,
quality string, and the value specified with --seed. If you run the same
version of Bowtie 2 on two reads with identical names, nucleotide strings, and
quality strings, and if --seed is set the same for both runs, Bowtie 2 will
produce the same output; i.e., it will align the read to the same place, even if
there are multiple equally good alignments. This is intuitive and desirable in
most cases. Most users expect Bowtie to produce the same output when run twice
on the same input.
However, when the user specifies the --non-deterministic option, Bowtie 2
will use the current time to re-initialize the pseudo-random number generator.
When this is specified, Bowtie 2 might report different alignments for identical
reads. This is counter-intuitive for some users, but might be more appropriate
in situations where the input consists of many identical reads.
Multiseed heuristic
To rapidly narrow the number of possible alignments that must be considered,
Bowtie 2 begins by extracting substrings ("seeds") from the read and its reverse
complement and aligning them in an ungapped fashion with the help of the FM
Index. This is "multiseed alignment" and it is similar to what Bowtie 1
does, except Bowtie 1 attempts to align the entire read this way.
This initial step makes Bowtie 2 much faster than it would be without such a
filter, but at the expense of missing some valid alignments. For instance, it
is possible for a read to have a valid overall alignment but to have no valid
seed alignments because each potential seed alignment is interruped by too many
mismatches or gaps.
The tradeoff between speed and sensitivity/accuracy can be adjusted by setting
the seed length (-L), the interval between extracted seeds (-i), and the
number of mismatches permitted per seed (-N). For more sensitive alignment,
set these parameters to (a) make the seeds closer together, (b) make the seeds
shorter, and/or (c) allow more mismatches. You can adjust these options
one-by-one, though Bowtie 2 comes with some useful combinations of options
pre-packaged as "preset options."
-D and -R are also options that adjust the tradeoff between speed and
sensitivity/accuracy.
FM Index memory footprint
Bowtie 2 uses the FM Index to find ungapped alignments for seeds. This step
accounts for the bulk of Bowtie 2's memory footprint, as the FM Index itself
is typically the largest data structure used. For instance, the memory
footprint of the FM Index for the human genome is about 3.2 gigabytes of RAM.
Ambiguous characters
Non-whitespace characters besides A, C, G or T are considered "ambiguous." N is
a common ambiguous character that appears in reference sequences. Bowtie 2
considers all ambiguous characters in the reference (including IUPAC nucleotide
codes) to be Ns.
Bowtie 2 allows alignments to overlap ambiguous characters in the reference. An
alignment position that contains an ambiguous character in the read, reference,
or both, is penalized according to --np. --n-ceil sets an upper limit
on the number of positions that may contain ambiguous reference characters in a
valid alignment. The optional field XN:i reports the number of ambiguous
reference characters overlapped by an alignment.
Note that the multiseed heuristic cannot find seed alignments that overlap
ambiguous reference characters. For an alignment overlapping an ambiguous
reference character to be found, it must have one or more seed alignments that
do not overlap ambiguous reference characters.
Presets: setting many settings at once
Bowtie 2 comes with some useful combinations of parameters packaged into shorter
"preset" parameters. For example, running Bowtie 2 with the --very-sensitive
option is the same as running with options: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50.
The preset options that come with Bowtie 2 are designed to cover a wide area of
the speed/sensitivity/accuracy tradeoff space, with the presets ending in fast
generally being faster but less sensitive and less accurate, and the presets
ending in sensitive generally being slower but more sensitive and more
accurate. See the documentation for the preset options for details.
Filtering
Some reads are skipped or "filtered out" by Bowtie 2. For example, reads may be
filtered out because they are extremely short or have a high proportion of
ambiguous nucleotides. Bowtie 2 will still print a SAM record for such a read,
but no alignment will be reported and and the YF:i SAM optional field will be
set to indicate the reason the read was filtered.
-
YF:Z:LN: the read was filtered becuase it had length less than or equal to
the number of seed mismatches set with the-Noption. -
YF:Z:NS: the read was filtered because it contains a number of ambiguous
characters (usuallyNor.) greater than the ceiling specified with
--n-ceil. -
YF:Z:SC: the read was filtered because the read length and the match bonus
(set with--ma) are such that the read can't possibly earn an alignment
score greater than or equal to the threshold set with--score-min -
YF:Z:QC: the read was filtered because it was marked as failing quality
control and the user specified the--qc-filteroption. This only happens
when the input is in Illumina's QSEQ format (i.e. when--qseqis specified)
and the last (11th) field of the read's QSEQ record contains1.
If a read could be filtered for more than one reason, the value YF:Z flag will
reflect only one of those reasons.
Alignment summmary
When Bowtie 2 finishes running, it prints messages summarizing what happened.
These messages are printed to the "standard error" ("stderr") filehandle. For
datasets consisting of unpaired reads, the summary might look like this:
20000 reads; of these:
20000 (100.00%) were unpaired; of these:
1247 (6.24%) aligned 0 times
18739 (93.69%) aligned exactly 1 time
14 (0.07%) aligned >1 times
93.77% overall alignment rate
For datasets consisting of pairs, the summary might look like this:
10000 reads; of these:
10000 (100.00%) were paired; of these:
650 (6.50%) aligned concordantly 0 times
8823 (88.23%) aligned concordantly exactly 1 time
527 (5.27%) aligned concordantly >1 times
----
650 pairs aligned concordantly 0 times; of these:
34 (5.23%) aligned discordantly 1 time
----
616 pairs aligned 0 times concordantly or discordantly; of these:
1232 mates make up the pairs; of these:
660 (53.57%) aligned 0 times
571 (46.35%) aligned exactly 1 time
1 (0.08%) aligned >1 times
96.70% overall alignment rate
The indentation indicates how subtotals relate to totals.
Wrapper scripts
The bowtie2, bowtie2-build and bowtie2-inspect executables are actually
wrapper scripts that call binary programs as appropriate. The wrappers shield
users from having to distinguish between "small" and "large" index formats,
discussed briefly in the following section. Also, the bowtie2 wrapper
provides some key functionality, like the ability to handle compressed inputs,
and the fucntionality for --un, --al and related options.
It is recommended that you always run the bowtie2 wrappers and not run the
binaries directly.
Small and large indexes
bowtie2-build can index reference genomes of any size. For genomes less than
about 4 billion nucleotides in length, bowtie2-build builds a "small" index
using 32-bit numbers in various parts of the index. When the genome is longer,
bowtie2-build builds a "large" index using 64-bit numbers. Small indexes are
stored in files with the .bt2 extension, and large indexes are stored in
files with the .bt2l extension. The user need not worry about whether a
particular index is small or large; the wrapper scripts will automatically build
and use the appropriate index.
Performance tuning
-
If your computer has multiple processors/cores, use
-pThe
-poption causes Bowtie 2 to launch a specified number of parallel
search threads. Each thread runs on a different processor/core and all
threads find alignments in parallel, increasing alignment throughput by
approximately a multiple of the number of threads (though in practice,
speedup is somewhat worse than linear). -
If reporting many alignments per read, try reducing
bowtie2-build --offrateIf you are using
-kor-aoptions and Bowtie 2 is reporting many
alignments per read, using an index with a denser SA sample can speed
things up considerably. To do this, specify a smaller-than-default
-o/--offratevalue when runningbowtie2-build.
A denser SA sample yields a larger index, but is also particularly
effective at speeding up alignment when many alignments are reported per
read. -
If
bowtie2"thrashes", try increasingbowtie2-build --offrateIf
bowtie2runs very slowly on a relatively low-memory computer, try
setting-o/--offrateto a larger value when building the index.
This decreases the memory footprint of the index.
Command Line
Setting function options
Some Bowtie 2 options specify a function rather than an individual number or
setting. In these cases the user specifies three parameters: (a) a function
type F, (b) a constant term B, and (c) a coefficient A. The available
function types are constant (C), linear (L), square-root (S), and natural
log (G). The parameters are specified as F,B,A - that is, the function type,
the constant term, and the coefficient are separated by commas with no
whitespace. The constant term and coefficient may be negative and/or
floating-point numbers.
For example, if the function specification is L,-0.4,-0.6, then the function
defined is:
f(x) = -0.4 + -0.6 * x
If the function specification is G,1,5.4, then the function defined is:
f(x) = 1.0 + 5.4 * ln(x)
See the documentation for the option in question to learn what the parameter x
is for. For example, in the case if the --score-min option, the function
f(x) sets the minimum alignment score necessary for an alignment to be
considered valid, and x is the read length.
Usage
bowtie2 [options]* -x {-1 -2 | -U } -S []
Main arguments
|
The basename of the index for the reference genome. The basename is the name of |
|
Comma-separated list of files containing mate 1s (filename usually includes |
|
Comma-separated list of files containing mate 2s (filename usually includes |
|
Comma-separated list of files containing unpaired reads to be aligned, e.g. |
|
File to write SAM alignments to. By default, alignments are written to the |
Options
Input options
|
Reads (specified with |
|
Reads (specified with |
|
Reads (specified with |
|
Reads (specified with |
|
The read sequences are given on command line. I.e. |
|
Skip (i.e. do not align) the first |
|
Align the first |
|
Trim |
|
Trim |
|
Input qualities are ASCII chars equal to the Phred quality plus 33. This is |
|
Input qualities are ASCII chars equal to the Phred quality plus 64. This is |
|
Convert input qualities from Solexa (which can be negative) to |
|
Quality values are represented in the read input file as space-separated ASCII |
Preset options in --end-to-end mode
|
Same as: |
|
Same as: |
|
Same as: |
|
Same as: |
Preset options in --local mode
|
Same as: |
|
Same as: |
|
Same as: |
|
Same as: |
Alignment options
|
Sets the number of mismatches to allowed in a seed alignment during multiseed |
|
Sets the length of the seed substrings to align during multiseed alignment. |
|
Sets a function governing the interval between seed substrings to use during Since it's best to use longer intervals for longer reads, this parameter sets |
|
Sets a function governing the maximum number of ambiguous characters (usually |
|
"Pads" dynamic programming problems by |
|
Disallow gaps within |
|
When calculating a mismatch penalty, always consider the quality value at the |
|
If |
|
By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch |
|
In this mode, Bowtie 2 requires that the entire read align from one end to the |
|
In this mode, Bowtie 2 does not require that the entire read align from one end |
Scoring options
|
Sets the match bonus. In |
|
Sets the maximum ( |
|
Sets penalty for positions where the read, reference, or both, contain an |
|
Sets the read gap open ( |
|
Sets the reference gap open ( |
|
Sets a function governing the minimum alignment score needed for an alignment to |
Reporting options
|
By default, When Note: Bowtie 2 is not designed with large values for |
|
Like Note: Bowtie 2 is not designed with |
Effort options
|
Up to |
|
|
Paired-end options
|
The minimum fragment length for valid paired-end alignments. E.g. if The larger the difference between Default: 0 (essentially imposing no minimum) |
|
The maximum fragment length for valid paired-end alignments. E.g. if The larger the difference between Default: 500. |
|
The upstream/downstream mate orientations for a valid paired-end alignment |
|
By default, when |
|
By default, |
|
If the mates "dovetail", that is if one mate alignment extends past the |
|
If one mate alignment contains the other, consider that to be non-concordant. |
|
If one mate alignment overlaps the other at all, consider that to be |
Output options
|
Print the wall-clock time required to load the index files and align the reads. |
|
Write unpaired reads that fail to align to file at |
|
Write unpaired reads that align at least once to file at |
|
Write paired-end reads that fail to align concordantly to file(s) at |
|
Write paired-end reads that align concordantly at least once to file(s) at |
|
Print nothing besides alignments and serious errors. |
|
Write |
|
Write |
|
Write a new |
SAM options
|
Suppress SAM records for reads that failed to align. |
|
Suppress SAM header lines (starting with |
|
Suppress |
|
Set the read group ID to |
|
Add |
|
When printing secondary alignments, Bowtie 2 by default will write out the |
Performance options
|
Override the offrate of the index with |
|
Launch |
|
Guarantees that output SAM records are printed in an order corresponding to the |
|
Use memory-mapped I/O to load the index, rather than typical file I/O. |
Other options
|
Filter out reads for which the QSEQ filter field is non-zero. Only has an |
|
Use |
|
Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It |
|
Print version information and quit. |
|
Print usage information and quit. |
SAM output
Following is a brief description of the SAM format as output by bowtie2.
For more details, see the SAM format specification.
By default, bowtie2 prints a SAM header with @HD, @SQ and @PG lines.
When one or more --rg arguments are specified, bowtie2 will also print
an @RG line that includes all user-specified --rg tokens separated by
tabs.
Each subsequnt line describes an alignment or, if the read failed to align, a
read. Each line is a collection of at least 12 fields separated by tabs; from
left to right, the fields are:
-
Name of read that aligned.
Note that the SAM specification disallows whitespace in the read name.
If the read name contains any whitespace characters, Bowtie 2 will truncate
the name at the first whitespace character. This is similar to the
behavior of other tools. -
Sum of all applicable flags. Flags relevant to Bowtie are:
1The read is one of a pair
2The alignment is one end of a proper paired-end alignment
4The read has no reported alignments
8The read is one of a pair and has no reported alignments
16The alignment is to the reverse reference strand
32The other mate in the paired-end alignment is aligned to the
reverse reference strand64The read is mate 1 in a pair
128The read is mate 2 in a pair
Thus, an unpaired read that aligns to the reverse reference strand
will have flag 16. A paired-end read that aligns and is the first
mate in the pair will have flag 83 (= 64 + 16 + 2 + 1). Name of reference sequence where alignment occurs
1-based offset into the forward reference strand where leftmost
character of the alignment occursMapping quality
CIGAR string representation of alignment
Name of reference sequence where mate's alignment occurs. Set to
=if the
mate's reference sequence is the same as this alignment's, or*if there is no
mate.1-based offset into the forward reference strand where leftmost character of
the mate's alignment occurs. Offset is 0 if there is no mate.Inferred fragment length. Size is negative if the mate's alignment occurs
upstream of this alignment. Size is 0 if the mates did not align concordantly.
However, size is non-0 if the mates aligned discordantly to the same
chromosome.Read sequence (reverse-complemented if aligned to the reverse strand)
ASCII-encoded read qualities (reverse-complemented if the read aligned to
the reverse strand). The encoded quality values are on the Phred quality
scale and the encoding is ASCII-offset by 33 (ASCII char!), similarly to a
FASTQ file.-
Optional fields. Fields are tab-separated.
bowtie2outputs zero or more
of these optional fields for each alignment, depending on the type of the
alignment:
AS:i:Alignment score. Can be negative. Can be greater than 0 in [`--local`] mode (but not in [`--end-to-end`] mode). Only present if SAM record is for an aligned read. XS:i:Alignment score for the best-scoring alignment found other than the alignment reported. Can be negative. Can be greater than 0 in [`--local`] mode (but not in [`--end-to-end`] mode). Only present if the SAM record is for an aligned read and more than one alignment was found for the read. Note that, when the read is part of a concordantly-aligned pair, this score could be greater than [`AS:i`]. YS:i:Alignment score for opposite mate in the paired-end alignment. Only present if the SAM record is for a read that aligned as part of a paired-end alignment. XN:i:The number of ambiguous bases in the reference covering this alignment. Only present if SAM record is for an aligned read. XM:i:The number of mismatches in the alignment. Only present if SAM record is for an aligned read. XO:i:The number of gap opens, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read. XG:i:The number of gap extensions, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read. NM:i:The edit distance; that is, the minimal number of one-nucleotide edits (substitutions, insertions and deletions) needed to transform the read string into the reference string. Only present if SAM record is for an aligned read. YF:Z:String indicating reason why the read was filtered out. See also: [Filtering]. Only appears for reads that were filtered out. YT:Z:Value of `UU` indicates the read was not part of a pair. Value of `CP` indicates the read was part of a pair and the pair aligned concordantly. Value of `DP` indicates the read was part of a pair and the pair aligned discordantly. Value of `UP` indicates the read was part of a pair but the pair failed to aligned either concordantly or discordantly. MD:Z:A string representation of the mismatched reference bases in the alignment. See [SAM] format specification for details. Only present if SAM record is for an aligned read. The
bowtie2-buildindexerbowtie2-buildbuilds a Bowtie index from a set of DNA sequences.
bowtie2-buildoutputs a set of 6 files with suffixes.1.bt2,.2.bt2,
.3.bt2,.4.bt2,.rev.1.bt2, and.rev.2.bt2. In the case of a large
index these suffixes will have abt2ltermination. These files together
constitute the index: they are all that is needed to align reads to that
reference. The original sequence FASTA files are no longer used by Bowtie 2
once the index is built.Bowtie 2's
.bt2index format is different from Bowtie 1's.ebwtformat, and
they are not compatible with each other.Use of Karkkainen's blockwise algorithm allows
bowtie2-buildto trade off
between running time and memory usage.bowtie2-buildhas three options
governing how it makes this trade:-p/--packed,--bmax/--bmaxdivn,
and--dcv. By default,bowtie2-buildwill automatically search for the
settings that yield the best running time without exhausting memory. This
behavior can be disabled using the-a/--noautooption.The indexer provides options pertaining to the "shape" of the index, e.g.
--offrategoverns the fraction of Burrows-Wheeler
rows that are "marked" (i.e., the density of the suffix-array sample; see the
original FM Index paper for details). All of these options are potentially
profitable trade-offs depending on the application. They have been set to
defaults that are reasonable for most cases according to our experiments. See
Performance tuning for details.bowtie2-buildcan generate either small or large indexes. The wrapper
will decide which based on the length of the input genome. If the reference
does not exceed 4 billion characters but a large index is preferred, the user
can specify--large-indexto forcebowtie2-buildto build a large index
instead.The Bowtie 2 index is based on the FM Index of Ferragina and Manzini, which in
turn is based on the Burrows-Wheeler transform. The algorithm used to build
the index is based on the blockwise algorithm of Karkkainen.Command Line
Usage:
bowtie2-build [options]*Main arguments
A comma-separated list of FASTA files containing the reference sequences to be
aligned to, or, if-cis specified, the sequences
themselves. E.g.,chr1.fa,chr2.fa,chrX.fa,chrY.fa,
or, if-cis specified, this might be
GGTCATCCT,ACGGGTCGT,CCGTTCTATGCGGCTTA.The basename of the index files to write. By default,
bowtie2-buildwrites
files namedNAME.1.bt2,NAME.2.bt2,NAME.3.bt2,NAME.4.bt2,
NAME.rev.1.bt2, andNAME.rev.2.bt2, whereNAMEisOptions
-fThe reference input files (specified as
(usually having extension.fa,.mfa,.fnaor similar).-cThe reference sequences are given on the command line. I.e.
a comma-separated list of sequences rather than a list of FASTA files.
--large-indexForce
bowtie2-buildto build a large index, even if the reference is less
than ~ 4 billion nucleotides inlong.
-a/--noautoDisable the default behavior whereby
bowtie2-buildautomatically selects
values for the--bmax,--dcvand--packedparameters according to
available memory. Instead, user may specify values for those parameters. If
memory is exhausted during indexing, an error message will be printed; it is up
to the user to try new parameters.-p/--packedUse a packed (2-bits-per-nucleotide) representation for DNA strings. This saves
memory but makes indexing 2-3 times slower. Default: off. This is configured
automatically by default; use-a/--noautoto configure manually.--bmaxThe maximum number of suffixes allowed in a block. Allowing more suffixes per
block makes indexing faster, but increases peak memory usage. Setting this
option overrides any previous setting for--bmax, or--bmaxdivn.
Default (in terms of the--bmaxdivnparameter) is--bmaxdivn4. This is
configured automatically by default; use-a/--noautoto configure manually.--bmaxdivnThe maximum number of suffixes allowed in a block, expressed as a fraction of
the length of the reference. Setting this option overrides any previous setting
for--bmax, or--bmaxdivn. Default:--bmaxdivn4. This is
configured automatically by default; use-a/--noautoto configure manually.--dcvUse
yields less memory overhead, but may make suffix sorting slower, especially if
repeats are present. Must be a power of 2 no greater than 4096. Default: 1024.
This is configured automatically by default; use-a/--noautoto configure
manually.--nodcDisable use of the difference-cover sample. Suffix sorting becomes
quadratic-time in the worst case (where the worst case is an extremely
repetitive reference). Default: off.-r/--norefDo not build the
NAME.3.bt2andNAME.4.bt2portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.-3/--justrefBuild only the
NAME.3.bt2andNAME.4.bt2portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.-o/--offrateTo map alignments back to positions on the reference sequences, it's necessary
to annotate ("mark") some or all of the Burrows-Wheeler rows with their
corresponding location on the genome.
-o/--offrategoverns how many rows get marked:
the indexer will mark every 2^
reference-position lookups faster, but requires more memory to hold the
annotations at runtime. The default is 5 (every 32nd row is marked; for human
genome, annotations occupy about 340 megabytes).-t/--ftabcharsThe ftab is the lookup table used to calculate an initial Burrows-Wheeler
range with respect to the first
4^(--seedUse
--cutoffIndex only the first
sequences) and ignore the rest.-q/--quietbowtie2-buildis verbose by default. With this optionbowtie2-buildwill
print only error messages.-h/--helpPrint usage information and quit.
--versionPrint version information and quit.
The
bowtie2-inspectindex inspectorbowtie2-inspectextracts information from a Bowtie index about what kind of
index it is and what reference sequences were used to build it. When run without
any options, the tool will output a FASTA file containing the sequences of the
original references (with all non-A/C/G/Tcharacters converted toNs).
It can also be used to extract just the reference sequence names using the
-n/--namesoption or a more verbose summary using the-s/--summary
option.Command Line
Usage:
bowtie2-inspect [options]*Main arguments
The basename of the index to be inspected. The basename is name of any of the
index files but with the.X.bt2or.rev.X.bt2suffix omitted.
bowtie2-inspectfirst looks in the current directory for the index files, then
in the directory specified in theBOWTIE2_INDEXESenvironment variable.Options
-a/--acrossWhen printing FASTA output, output a newline character every
(default: 60).-n/--namesPrint reference sequence names, one per line, and quit.
-s/--summaryPrint a summary that includes information about index settings, as well as the
names and lengths of the input sequences. The summary has this format:Colorspace <0 or 1> SA-Sample 1 inFTab-Chars Sequence-1 Sequence-2 ... Sequence-N Fields are separated by tabs. Colorspace is always set to 0 for Bowtie 2.
-v/--verbosePrint verbose output (for debugging).
--versionPrint version information and quit.
-h/--helpPrint usage information and quit.
Getting started with Bowtie 2: Lambda phage example
Bowtie 2 comes with some example files to get you started. The example files
are not scientifically significant; we use the Lambda phage reference genome
simply because it's short, and the reads were generated by a computer program,
not a sequencer. However, these files will let you start running Bowtie 2 and
downstream tools right away.First follow the manual instructions to obtain Bowtie 2. Set the
BT2_HOME
environment variable to point to the new Bowtie 2 directory containing the
bowtie2,bowtie2-buildandbowtie2-inspectbinaries. This is important,
as theBT2_HOMEvariable is used in the commands below to refer to that
directory.Indexing a reference genome
To create an index for the Lambda phage reference genome included with Bowtie
2, create a new temporary directory (it doesn't matter where), change into that
directory, and run:$BT2_HOME/bowtie2-build $BT2_HOME/example/reference/lambda_virus.fa lambda_virusThe command should print many lines of output then quit. When the command
completes, the current directory will contain four new files that all start with
lambda_virusand end with.1.bt2,.2.bt2,.3.bt2,.4.bt2,
.rev.1.bt2, and.rev.2.bt2. These files constitute the index - you're done!You can use
bowtie2-buildto create an index for a set of FASTA files obtained
from any source, including sites such as UCSC, NCBI, and Ensembl. When
indexing multiple FASTA files, specify all the files using commas to separate
file names. For more details on how to create an index withbowtie2-build,
see the manual section on index building. You may also want to bypass this
process by obtaining a pre-built index. See using a pre-built index below
for an example.Aligning example reads
Stay in the directory created in the previous step, which now contains the
lambda_virusindex files. Next, run:$BT2_HOME/bowtie2 -x lambda_virus -U $BT2_HOME/example/reads/reads_1.fq -S eg1.samThis runs the Bowtie 2 aligner, which aligns a set of unpaired reads to the
Lambda phage reference genome using the index generated in the previous step.
The alignment results in SAM format are written to the fileeg1.sam, and a
short alignment summary is written to the console. (Actually, the summary is
written to the "standard error" or "stderr" filehandle, which is typically
printed to the console.)To see the first few lines of the SAM output, run:
head eg1.samYou will see something like this:
@HD VN:1.0 SO:unsorted @SQ SN:gi|9626243|ref|NC_001416.1| LN:48502 @PG ID:bowtie2 PN:bowtie2 VN:2.0.1 r1 0 gi|9626243|ref|NC_001416.1| 18401 42 122M * 0 0 TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG +"@6<:27(F&5)9)"B:%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C> AS:i:-5 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:59G13G21G26 YT:Z:UU r2 0 gi|9626243|ref|NC_001416.1| 8886 42 275M * 0 0 NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC (#!!'+!$""%+(+)'%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(#")(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+ AS:i:-14 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:0A0C0G0A108C23G9T81T46 YT:Z:UU r3 16 gi|9626243|ref|NC_001416.1| 11599 42 338M * 0 0 GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT 7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04CThe first few lines (beginning with
@) are SAM header lines, and the rest of
the lines are SAM alignments, one line per read or mate. See the Bowtie 2
manual section on SAM output and the SAM specification for details about how
to interpret the SAM file format.Paired-end example
To align paired-end reads included with Bowtie 2, stay in the same directory and
run:$BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.samThis aligns a set of paired-end reads to the reference genome, with results
written to the fileeg2.sam.Local alignment example
To use local alignment to align some longer reads included with Bowtie 2, stay
in the same directory and run:$BT2_HOME/bowtie2 --local -x lambda_virus -U $BT2_HOME/example/reads/longreads.fq -S eg3.samThis aligns the long reads to the reference genome using local alignment, with
results written to the fileeg3.sam.Using SAMtools/BCFtools downstream
SAMtools is a collection of tools for manipulating and analyzing SAM and BAM
alignment files. BCFtools is a collection of tools for calling variants and
manipulating VCF and BCF files, and it is typically distributed with SAMtools.
Using these tools together allows you to get from alignments in SAM format to
variant calls in VCF format. This example assumes thatsamtoolsand
bcftoolsare installed and that the directories containing these binaries are
in your PATH environment variable.Run the paired-end example:
$BT2_HOME/bowtie2 -x $BT2_HOME/example/index/lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.samUse
samtools viewto convert the SAM file into a BAM file. BAM is a the
binary format corresponding to the SAM text format. Run:samtools view -bS eg2.sam > eg2.bamUse
samtools sortto convert the BAM file to a sorted BAM file.samtools sort eg2.bam eg2.sortedWe now have a sorted BAM file called
eg2.sorted.bam. Sorted BAM is a useful
format because the alignments are (a) compressed, which is convenient for
long-term storage, and (b) sorted, which is conveneint for variant discovery.
To generate variant calls in VCF format, run:samtools mpileup -uf $BT2_HOME/example/reference/lambda_virus.fa eg2.sorted.bam | bcftools view -bvcg - > eg2.raw.bcfThen to view the variants, run:
bcftools view eg2.raw.bcfSee the official SAMtools guide to Calling SNPs/INDELs with SAMtools/BCFtools
for more details and variations on this process.